A novel biomarker for marine environmental pollution of. Alternatively, cdna compatible with trimmer2 protocol can be prepared using clontech smarttm cdna library construction kit cat. A solution to this problem can be found in clontechs smart cdna synthesis kit. Clontech labs 3psmarter race 53 kit, 20 rxns fisher. Smarter pico pcr cdna synthesis kit user manual 020916. Smartseq v4 reagent kit for the smarter apollo system. Clontech labs 3psmarter race 53 kit, 10 rxns fisher. Introduction smarter cdna synthesis for the illumina sequencing platform the smarter stranded total rna sample prep kit hi mammalian cat. Libraries generated with the pico v1 or pico v2 kits were pooled and run on nextseq 500 or miniseq instruments, as indicated. Here we describe a reversetranscriptasebased method for obtaining fulllength cdnas using the smarter switching mechanism at rna termini race technology developed by clontech.
The smarter race 53 kit has been improved to accommodate larger rna input volumes and perform better on challenging targets than the original smarter race cdna amplification kit. Smarter stranded total rnaseq kit v2 pico input mammalian. I suggest you follow the exact protocol from clontech, and use everything they provided, as pratima. Smarter race cdna amplification kit user manual hackbio. A gc1qr prevents white spot syndrome virus replication in. Race products for various rna targets using the neb template switching rt enzyme mix 5. The genespecific primers were designed and synthesized according to the above sequenced 3. Molecular cloning, characterization and functional. This abbreviated protocol is provided for your convenience, but is not intended for firsttime users. Flowery odor formation revealed by differential expression. Smarter stranded total rna sample prep kit hi mammalian user manual 082614. Molecular cloning, characterization and expression.
Workflow for cdna preparation with the smarter apollo system and the smartseq v4 reagent kit for the smarter apollo system. The same master mix can be used for both 5 and 3 race reactions. Smart race kit is also creatorcompatible, so it can be used to prepare cdna for product size cat. To generate race ready cdna, the smarter race cdna amplification kit was used following the user manual clontech, mountain view, ca, usa. Smarter cdna synthesis for rapid amplification of cdna ends race. Smarter race cdna amplification kit user manual protocol no. Flowery odor formation revealed by differential expression of. Prepare enough pcr master mix for all of the reactions plus one additional tube. The incorporation of bd smart technology also permits.
Kit, designed to accommodate larger rna input volumes. Race pcr products are amplified with our highly robust seqamp dna polymerase, and cloned into the linearized prace vector with infusion. Four 158 genespecific primers, elovl4f1, elovl4f2, elovl4r1 and elvol4r2 were designed 159 for the amplification of race cdna fragments based on the obtained elovl4 cdna. And the race is on to obtain that potentially elusive fulllength cdna for characterizing the best gene ever. Please read the user manual for the smarter race 53 kit cat. In the molecular biology arena, race refers to rapid amplification of cdna ends, a pcrbased cloning strategy used to obtain clones representing transcripts of the int2 gene, expressed at low abundance. Introduction protocoloverview, continued following reverse transcription, smart technology allows rststrand cdna useddirectly 3racepcr reactions. For the race pcr reaction, two genespecific primers, fad93rf and fad95rr table 1, were designed based on the obtained acylcoa. I plan to perform 5 race pcr using either the smarter kit from clontech or the invitrogen kit 5 race system for rapid amplification of cdna. The polymerase mix is comprised of titanium taq dna polymerasea. Pr661862 smart race cdna amplification kit user manual. The smarter pcr cdna synthesis kit does not differentiate between a fulllength mrna sequence and that of a degraded mrna fragment. Bd smart race cdna amplification kit user manual i.
Clontech labs 3p smarter race 53 kit, 20 rxns manufacturer. The 3 and 157 5ends cdna templates were synthesized according to the user s manual. Total rna of liver tissue from the same 4 month large white pig was chosen as template for synthesis of prdx6 cdna. Race results in the production of a cdna copy of the rna sequence of interest, produced through reverse transcription, followed by pcr amplification. However, in this case, the original protocol of cdna synthesis requires special modifications. Rapid amplification of cdna ends race rapid amplification of cdna ends race is a technique used in molecular biology to obtain the full length sequence of an rna transcript found within a cell. Dtsd cdna s 3 end was amplified using 3genespecific primers and the universal primers provided by the kit. Applications such as northern blot analysis, cdna library construction and cdna subtraction are demanding when it comes to starting material. General considerations for bd smart race amplification 11 v.
Smart race cdna amplification kit user manual table of contents i. Race cdna amplification kit user manual now including. The expression of porcine prdx6 gene is upregulated by c. I plan to perform 5 race pcr using either the smarter kit from clontech or the invitrogen kit 5 race system for rapid amplification of cdna ends, version 2. If the input rna is not high quality, the result is a cdna library that will show an overall 3 bias. Clontech smarter pcr cdna synthesis kit with no size selection no 1. Clontech s smart race cdna amplification process diagram on your mark, get set, go. Instructions for firststrand cdna synthesis, from the clontech smarter pcr cdna synthesis kit, have been. We performed 5 race with the smarter race complementary dna cdna amplification kit 634859. Bd advantage 2 pcr enzyme system user manual bd advantage 2 pcr kit cat. Smarter race cdna amplification is a flexible toolmany researchers use this kit in place of conventional kits to amplify just the 5 or 3 end of a particular cdna. With the workflow described in this user manual, synthesis and purification of cdna from any number of samples can be completed in approximately 910 hours, prior to validation figure 1.
What is the best race kit for amplify full cdna genes. Dna methyltransferases have an essential role in female. Introduction the smarter race 53 kit provides a method for performing both 5 and 3rapid amplification of cdna. This kit incorporates takara bios proprietary smart switching mechanism at the 5 end of rna template technology and includes refinements to the smarter method for stranded rnaseq that simplify. M 5aagcagtggtatcaacgcagagtact30 v n3 n a, c, g, smarter. Genomewalker reactions should be performed with the included advantage 2 pcr kit cat. The 5 race ready cdna and 3 race ready cdna templates were prepared according to the smarter race cdna amplification kit user manual. Clontech 2009 smarter race cdna amplification kit user manual. The pcr for 5 race and 3 race was performed using smarter race cdna amplification kit clontech, japan following the user manual.
Polymerase chain reaction amplification programme was set as follows. The smarter race 53 kit is an improved version of our original smarter race cdna amplification. Clontechs smart cdna synthesis kit biocompare product. The kit utilizes our smart switching mechanism at 5 end of rna template technology coupled with pcr amplification to generate high yields of fulllength doublestranded cdna suitable for various applications, including clontech pcrselect cdna subtraction, nondirectional cloning, and preparation. Smarter pcr cdna synthesis kit user manual protocol no. General considerations for smart race amplification 11 v. Different routes of aeromonas hydrophila infection lead to. The smarter stranded total rnaseq kit v2 pico input mammalian is used to generate strandspecific rnaseq libraries for illumina sequencing from 250 pg10 ng inputs of purified total rna. Smarter race cdna amplification kit clontech laboratories, inc. Cloning fulllength transcripts and transcript variants. The infusion hd cloning kit, nucleospin gel and pcr cleanup kit, and stellar competent cells are included for your convenience in cloning race products. A takara bio company page 7 of 34 synthesize smarter cdna for rapid amplification of cdna ends race the smarter cdna synthesis method is also optimized for rapid amplification of cdna ends race. The smarter ii a oligonucleotide anneals to the tail of the cdna and serves as an extend ed template for smartscribe rt. Can anyone suggest basic protocol for 5 and 3 race pcr.
Smarter stranded total rna sample prep kit hi mammalian. Bd smart race cdna amplification kit user manual table of contents i. For marathonready cdnas, cdna synthesis and adaptor ligation are performed at clontech 5 andor 3 race can be completed in one day. The 3 race ready cdna and 5 race ready cdna were used as templates for 3 race and 5 race respectively. Our carefully designed, speciallymodified smarter oligo preferentially captures the 5 ends of the cdna during cdna synthesis. Selectively enhanced expression of prophenoloxidase. In a lobind microcentrifuge tube, add the following reagents. The kit utilizes our smart switching mechanism at 5 end of rna template technology coupled with pcr amplification to generate high yields of fulllength doublestranded cdna suitable for various applications, including clontech pcrselect cdna subtraction, nondirectional cloning, and preparation of complex cdna probes.
Race was performed using a smarter race cdna amplification kit clontech, usa, according to the manufacturers user manual. This document describes methods for generating fulllength cdna libraries. Characterization of bmp15 and its regulation by human. The smarter pcr cdna synthesis kit includes the same components as the original smart pcr cdna synthesis kit plus an improved smarter ii a oligo and smartscribe reverse. Smartscribe rt then switches templates and continues replicating to the end of the oligonucleotide chenchik et al. Please read the user manual for the smarter race cdna amplification kit cat. Clontech products are to be used for research purposes only. Improved passfilter rates %pf with the smarter stranded total rnaseq kit v2 pico input mammalian. Race kit rapid amplification of cdna ends is used for amplification of 3 or 5 of cdna. If you need to amplify the whole length of cdna you need a good reverse transcriptase, not race kit. Aug 14, 2015 the cdna synthesis was carried out using the primescript rt reagent kit with gdna eraser following the manufacturers instructions takara, otsu, japan. The reverse transcription kit utilized for this method, the smarter pcr cdna synthesis kit from clontech, requires the presence of a polyatail in order to generate fulllength cdna. Molecular characterization, tissue expression of acylcoa. To increase the amplification efficiency and specificity, the race pcr product was diluted 100.
Improved sequencing performance with the smarter stranded total rnaseq kit v2 pico input mammalian. Race system for rapid amplification of cdna ends, version 2. Generating raceready cdna section v of the user manual. Race ready firststand cdna according to the smarter race cdna amplification kit user manual clontech. A novel biomarker for marine environmental pollution of cat. For the first pcr amplification of 3 race, dtsd31 5. Smarterrace cdna amplication kit user manual protocol pt40961. Clontech labs 3psmarter race 53 kit, 20 rxns fisher scientific. User bulletin guidelines for preparing cdna libraries for. The race pcr amplification procedure was carried out using a touchdown pcr according to the manual. Race were carried out using the smarter race cdna amplification kit clontech, mountain view, ca, usa following the manufacturers protocol. The smarter race 53 kit is an impr oved version of our original smarter race cdna amplification kit, designed to accommodate larger rna input volumes and perform more efficiently on challenging targets e. Bd smart race cdna amplification, bd clontech pcrselect subtrac.
129 672 550 244 1664 1165 147 638 1598 1133 1133 1500 436 316 649 1288 1632 864 1233 131 797 110 1410 212 1617 1612 427 1472 1480 84 1286 1571 287 693 484 1541